rs1137566 chr7:134995449 T>G
- Sequence
tgccctcagtcacaggagtcacca[T/G]cagcagctcagagtggggagagtt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.02 | 0.51 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, diastolic blood pressure (dbp), hdl cholesterol, late onset alzheimers disease, ldl cholesterol, parkinsons disease, serum dehydroepiandrosterone sulphate (dheas), sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), years of education
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis