rs113920358 chr7:151341801 C>T
- Sequence
atgaaaacaaacggcggccgctgc[C/T]gcatccgggcactctgctggtcgc
- ASB in cell types
- foreskin keratinocyte breast tumor tissue
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.92 | -1.77 | 2.00 | |||
| breast tumor tissue | 0.92 | -0.84 | 2.50 |
Items per page:
1 – 2 of 2