rs113931622 chr6:49741057 C>T
- Sequence
agagcttgcagtgagccgagatcg[C/T]gccactgccctgggcgacagagcg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- KAISO_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KAISO_HUMAN | 3.47 | n/a | 3.00 | -3.34 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood