rs114172030 chr1:32901103 T>A
- Sequence
agtgacccgaccccggcctcgtag[T/A]aagttagaggcagagcaggtggcc
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
- ASB for transcription factors
- PRDM9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRDM9_HUMAN | -0.87 | 1.24 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1