rs114227105 chr6:28747806 C>T
- Sequence
tctgacggtgcagggttcaagtcc[C/T]tgttcaggcgaaatatttgtgtgt
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.84 | -0.30 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Testis, Thyroid, Whole_Blood