rs114357011 chr16:88527420 C>T
- Sequence
gtctgggtggcctgcacctccgag[C/T]acccggggatgaagcgggaggccc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.20 | 0.72 | 1.82 | |||
| GM12878 (female B-cells) | 1.83 | n/a | 1.33 | |||
| K562 (myelogenous leukemia) | 1.79 | n/a | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.83 | -0.54 | 2.00 |
Items per page:
1 – 4 of 4