rs1147598 chr10:97210907 G>A
- Sequence
atggattatactgattacatattg[G/A]ttttctattgattacacattcaaa
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.45 | 1.91 | 2.50 | |||
| A549 (lung carcinoma) | 0.70 | -0.33 | 2.00 |
Items per page:
1 – 2 of 2