rs115036873 chr9:26191924 G>C
- Sequence
agtgaggcctttgggaggtgatta[G/C]gtcatcatggtggagtcctcatga
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | n/a | 3.32 | 1.33 | 8.26 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
