rs1153322 chr21:14308498 G>A
- Sequence
cattcattacttatttgacttctg[G/A]gttgaaggtaattggttctaaaat
- ASB in cell types
- K562 (myelogenous leukemia) monocyte-derived macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.17 | 0.77 | 2.00 | |||
| monocyte-derived macrophages | 1.08 | -3.11 | 2.50 |
Items per page:
1 – 2 of 2