rs115410971 chr6:30814884 T>G
- Sequence
tttcactcttattgcccaggcttg[T/G]gtgtggtggcctgacctcagctca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ENL_HUMAN KDM1A_HUMAN ZN592_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ENL_HUMAN | 2.28 | n/a | 3.00 | n/a | n/a | |||
| KDM1A_HUMAN | 2.42 | n/a | 3.00 | n/a | n/a | |||
| ZN592_HUMAN | 2.63 | n/a | 3.00 | n/a | n/a | |||
| NR2C1_HUMAN | 2.10 | -0.91 | 3.00 | n/a | No Hit | |||
| CEBPB_HUMAN | 2.05 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood