rs11543 chr10:75210855 G>C
- Sequence
cttcacttcgccctccagctgctg[G/C]agctgcagcccgaccgcgagcgtg
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia) T47D (invasive ductal carcinoma) SK-BR-3 (breast adenocarcinoma)
- ASB for transcription factors
- RFOX2_HUMAN TBP_HUMAN SMAD5_HUMAN ZN148_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFOX2_HUMAN | 2.42 | -2.84 | 1.33 | n/a | n/a | |||
| TBP_HUMAN | 2.17 | -2.07 | 1.33 | n/a | No Hit | |||
| SMAD5_HUMAN | 1.82 | -2.28 | 1.42 | n/a | n/a | |||
| ZN148_HUMAN | 2.20 | -2.01 | 1.33 | n/a | n/a | |||
| VEZF1_HUMAN | 1.94 | -1.84 | 1.33 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Vagina, Whole_Blood