rs1155021 chr8:97170615 A>G
- Sequence
caagcttctagttgtcctctccca[A/G]tggggttgtatgaacaacacttaa
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.11 | -1.28 | 1.75 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, college completion, hdl cholesterol, primary rhegmatogenous retinal detachment, systolic blood pressure (sbp), years of education