rs11571378 chr12:950115 A>T
- Sequence
tctgaggatgaatggttgtcagag[A/T]ccttcccagattccgcccgggccg
- ASB in cell types
- HEK293 (embryonic kidney) neutrophils erythroid cells RWPE2
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.28 | 1.15 | 2.01 | |||
| neutrophils | 0.49 | 2.56 | 1.50 | |||
| erythroid cells | -3.21 | 2.38 | 2.00 | |||
| RWPE2 | -0.77 | 0.77 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.09 | 0.71 | 1.77 |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood