rs11577892 chr1:147721871 T>G
- Sequence
acacaatgcccagcacacactcca[T/G]aggtggtgtggccagaatgcaaat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- MNT_HUMAN CLOCK_HUMAN FOS_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | n/a | 2.69 | 2.50 | n/a | n/a | |||
| CLOCK_HUMAN | -1.24 | 2.26 | 2.50 | n/a | No Hit | |||
| FOS_HUMAN | -1.55 | 2.09 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hdl cholesterol, hypertension (early onset hypertension), ldl cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach