rs11585114 chr1:99681835 C>T
- Sequence
actttgccaaatatccccagggaa[C/T]aaaatcgcctctggttacgaacca
- ASB in cell types
- HEK293 (embryonic kidney) OVCAR8 (high grade ovarian serous adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.76 | -0.02 | 1.98 | |||
| OVCAR8 (high grade ovarian serous adenocarcinoma) | -2.46 | 1.96 | 1.50 |
Items per page:
1 – 2 of 2