rs11588450 chr1:46535324 T>C
- Sequence
gaggtggcagccctactgagactc[T/C]agccagaatcaccttgttgccgta
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.64 | 0.53 | 1.40 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Lung, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood