rs11591900 chr10:101012963 C>T
- Sequence
ccccactgactctgaagacctgaa[C/T]actgggagccatcccatttggaca
- ASB in cell types
- A549 (lung carcinoma) HepG2 (hepatoblastoma) foreskin keratinocyte fibroblast of dermis
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.98 | -0.18 | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.26 | 0.57 | 1.30 | |||
| foreskin keratinocyte | 0.33 | n/a | 2.50 | |||
| fibroblast of dermis | 1.92 | -1.77 | 2.00 |
Items per page:
1 – 4 of 4