rs11596745 chr10:44932894 G>A
- Sequence
caccagggggcaccagtgagccat[G/A]gcagtccagcctgcgagcataaga
- ASB in cell types
- K562 (myelogenous leukemia) MM1.S (plasma cell myeloma) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.48 | 0.58 | 1.43 | |||
| MM1.S (plasma cell myeloma) | 0.94 | -0.03 | 1.37 | |||
| epidermal keratinocytes | 1.87 | -1.11 | 2.00 |
Items per page:
1 – 3 of 3