rs11603334 chr11:72721940 G>A
- Sequence
cccaagaatgtcgtgtacctgccc[G/A]tgcaagcctgggtcccgcctgggc
- ASB in cell types
- K562 (myelogenous leukemia) breast tumor tissue
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.78 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI body mass index, fasting blood glucose, fasting blood glucose (bmi interaction), fasting blood proinsulin levels, glycated hemoglobin levels, proinsulin levels
GRASP 2 hour glucose, 2 hour glucose in non-diabetics, 2-hour glucose tolerance test, 32,33-split proinsulin in non-diabetics, brachial circumference (male), college completion, fasting blood glucose, fasting blood glucose in high bmi subjects, fasting blood glucose in low bmi subjects, fasting blood glucose in non-diabetics, fasting insulin, fasting insulin in non-diabetics, fasting proinsulin levels in non-diabetics, glycated hemoglobin (hba1c), glycated hemoglobin (hba1c) in nondiabetics, homa-b, homa-b in non-diabetics, homa-ir, insulin processing and secretion, insulinogenic index in non-diabetics, type 2 diabetes, years of education
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Heart_Left_Ventricle, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood