rs11609960 chr12:124927337 T>C
- Sequence
aaatacggaagaatggtaaaaacg[T/C]acttggcctccccgtcggggaatc
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) GM12878 (female B-cells) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.17 | 1.09 | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.54 | 0.41 | 1.27 | |||
| GM12878 (female B-cells) | 0.63 | 0.29 | 1.28 | |||
| T47D (invasive ductal carcinoma) | 0.93 | -0.06 | 1.44 |
Items per page:
1 – 4 of 4