rs11610486 chr12:113863418 G>A
- Sequence
gggaaagaagtgagaggaaggctg[G/A]agcagaggaagcgagaaccctcca
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) monocyte-derived macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.71 | -0.16 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.83 | -0.14 | 2.04 | |||
| monocyte-derived macrophages | 1.28 | n/a | 2.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach, Thyroid