rs11614869 chr12:113048736 G>T
- Sequence
acttagcttagatagaattgagat[G/T]gtaaattttatggtatgcatgttt
- ASB in cell types
- epithelial cell of prostate foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | 0.71 | -0.71 | 1.00 | |||
| foreskin keratinocyte | 0.41 | n/a | 2.50 |
Items per page:
1 – 2 of 2