rs11621659 chr14:37578238 G>A
- Sequence
ctacacatcatgcagaattgtgtg[G/A]catttcagttaagagggtgttaga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.05 | 0.83 | 1.52 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood