rs11629242 chr14:94395179 A>G
- Sequence
ctgtaactcctaaatacacagctc[A/G]atacatttttacatgtgtgtgcat
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | n/a | 1.43 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), major depressive disorder, multiple sclerosis, age of onset, neuroblastoma (brain cancer), refractive error, salmonella-induced pyroptosis, sporadic creutzfeldt-jakob disease, tetrology of fallot