rs11634587 chr15:63487553 T>C
- Sequence
ctctgcgcggaaggcccgagagaa[T/C]tggtcccgcagagcttttacaaag
- ASB in cell types
- LNCaP (prostate carcinoma) MCF7 (Invasive ductal breast carcinoma) erythroid cells hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 0.99 | -1.11 | 1.17 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.79 | 0.35 | 1.61 | |||
| erythroid cells | -3.24 | 2.41 | 2.00 | |||
| hepatocytes | 0.48 | 1.23 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | -1.70 | 2.10 | 2.50 |
Items per page:
1 – 5 of 6