rs11636161 chr15:67125766 G>A
- Sequence
aggatgacagaggagcctgctgct[G/A]agttcactggtgctggggttaggt
- ASB in cell types
- HCT-116 (colon carcinoma) HT29 (colon adenocarcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 0.98 | -0.34 | 1.31 | |||
| HT29 (colon adenocarcinoma) | -1.75 | 1.42 | 2.50 | |||
| A549 (lung carcinoma) | 0.41 | 0.59 | 1.24 |
Items per page:
1 – 3 of 3