rs11639511 chr16:10883987 C>G
- Sequence
atacatttgttataatcaatgaac[C/G]tacattgatgcatcattattaccc
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.89 | 1.24 | 2.81 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Colon_Sigmoid, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood