rs11644990 chr16:88992977 C>G
- Sequence
ctgagtctctgagtcggttcacat[C/G]agccctcgaatctaaccgaatcca
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.66 | n/a | 2.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Whole_Blood