rs11646115 chr16:87945556 G>A
- Sequence
aacggctgctcccattctcagaca[G/A]gaggacagagctgccagccggaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia) HCT-116 (colon carcinoma)
- ASB for transcription factors
- HCFC1_HUMAN EMSY_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HCFC1_HUMAN | 2.00 | -1.78 | 1.50 | n/a | n/a | |||
| EMSY_HUMAN | -2.87 | 2.20 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, comorbid depressive syndrome and alcohol dependence, schizophrenia, sporadic creutzfeldt-jakob disease, triglycerides change with statins