rs11655647 chr17:8785947 A>G
- Sequence
agctttgggaagggaatagggacc[A/G]ggtttgcccaatgaagagggacgc
- ASB in cell types
- A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.19 | -0.41 | 2.99 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.09 | 0.75 | 1.50 | |||
| VCaP (prostate carcinoma) | 1.46 | -0.82 | 2.00 |
Items per page:
1 – 3 of 3