rs11658760 chr17:78130995 G>T
- Sequence
acaggtcctcatcaggggctcgcg[G/T]ggtacctgggactggaggctggac
- ASB in cell types
- GM12878 (female B-cells) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.23 | 0.64 | 1.28 | |||
| K562 (myelogenous leukemia) | -0.14 | 0.60 | 1.99 |
Items per page:
1 – 2 of 2