rs11662764 chr18:58494025 C>T
- Sequence
ctcgtcgcctccccgggaactccc[C/T]gactggctggagagaagcatgagt
- ASB in cell types
- erythroid progenitors epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 1.55 | n/a | 2.50 | |||
| epidermal keratinocytes | 1.77 | 0.66 | 2.00 |
Items per page:
1 – 2 of 2