rs11672931 chr19:4811659 T>C
- Sequence
agtgaaggttcctgggccgaattc[T/C]ttttcagtcactttaaggaacagg
- ASB in cell types
- K562 (myelogenous leukemia) MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.50 | -0.16 | 2.00 | |||
| MM1.S (plasma cell myeloma) | 1.34 | -1.17 | 1.75 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood