rs11672978 chr19:46280960 T>C
- Sequence
tgccacgagagggcgtgtcaggct[T/C]agttagggcttagctgccagcagc
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.19 | 0.70 | 2.01 | |||
| A549 (lung carcinoma) | 0.52 | 0.34 | 1.47 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Whole_Blood