rs11679742 chr2:38438196 T>C
- Sequence
tccagcaaaacaagaattcccctg[T/C]tgtgttcaagctatgtccaaagat
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.07 | -0.07 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), bipolar disorder, diastolic blood pressure (dbp), hdl cholesterol change with statins, hypertension (early onset hypertension), systolic blood pressure (sbp), triglycerides
GTEx eQTL Breast_Mammary_Tissue, Minor_Salivary_Gland, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid