rs11681572 chr2:72166014 G>A
- Sequence
tagaaaatgaagcaactgccttag[G/A]aaacattttggcagtttctcaaca
- ASB in cell types
- SUM159PT (pleiomorphic breast carcinoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 1.41 | -0.06 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellum, Esophagus_Muscularis, Nerve_Tibial, Pancreas, Whole_Blood