rs11682382 chr2:119544252 G>A
- Sequence
gtgtggtgtttccaactttctcat[G/A]tcccctcgggaatccattcgtatc
- ASB in cell types
- HT29 (colon adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT29 (colon adenocarcinoma) | 1.69 | -1.84 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, breast size (bra cup size in women), diabetic retinopathy in type 2 diabetes mellitus, tetrology of fallot, total cholesterol change with statins, variant creutzfeldt-jakob disease
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Pancreas