rs11693750 chr2:113078025 C>T
- Sequence
caggtgttttccaggcagagaacg[C/T]agggatgggcatcccaggcagaaa
- ASB in cell types
- keratinocytes coronary artery smooth muscle
- ASB for transcription factors
- SNAI2_HUMAN JUND_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | -3.53 | 2.89 | 1.33 | n/a | No Hit | |||
| JUND_HUMAN | 1.25 | -0.83 | 1.67 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid