rs11694560 chr2:207394662 C>A
- Sequence
agagactacatttctcactccccc[C/A]actagcttctagggaagttcatgt
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PRD10_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRD10_HUMAN | 2.52 | -2.76 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), diabetic retinopathy in type 2 diabetes mellitus, infant head circumference