rs11694875 chr2:100116383 C>T
- Sequence
atattgggctgtaagtctaccatt[C/T]gcaaggagctatttgttctgatcg
- ASB in cell types
- VCaP (prostate carcinoma) LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.20 | 1.16 | 1.90 | n/a | No Hit | |||
| ANDR_HUMAN | 0.51 | 1.08 | 1.87 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting insulin, hdl cholesterol, height, obesity with early age of onset (age >2), rheumatoid arthritis, total cholesterol, type 1 diabetes, rheumatoid arthritis, combined case analysis, years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Lung, Thyroid, Whole_Blood