rs11698812 chr20:45319581 A>C
- Sequence
tgtctcctctaggctgccatcttc[A/C]tggggaaaggagctcttatctctg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.71 | -0.28 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.55 | -0.04 | 2.04 | |||
| foreskin keratinocyte | 0.79 | n/a | 2.67 |
Items per page:
1 – 3 of 3