rs116990655 chr17:82230852 C>T
- Sequence
gcccatctgtgaaatgggccacgc[C/T]gggcagccgcacgcaacggaaccg
- ASB in cell types
- A549 (lung carcinoma) LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.28 | 0.73 | 2.93 | |||
| LNCaP C4-2B (prostate carcinoma) | 1.15 | -0.63 | 1.25 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid