rs117052393 chr12:127363554 A>C
- Sequence
aaagaaaacactataatcaggaag[A/C]agagctcttcctcagctgtccctt
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.36 | 0.65 | 2.02 | |||
| foreskin keratinocyte | 1.40 | -2.52 | 2.50 |
Items per page:
1 – 2 of 2