rs117064558 chr7:156894119 T>G
- Sequence
tcatttagtttttgtttttgtttt[T/G]tttttttttgagacagagtttcac
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.55 | 0.48 | 1.52 | |||
| HEK293 (embryonic kidney) | -0.36 | 0.59 | 1.91 | |||
| HEK293T (embryonic kidney) | -0.64 | 0.87 | 1.93 |
Items per page:
1 – 3 of 3