rs11706730 chr3:9897936 G>A
- Sequence
ccagagttcatgcacagataaggc[G/A]gtgacaagaaaaatggctgcccaa
- ASB in cell types
- GM12878 (female B-cells) HEK293 (embryonic kidney) liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.26 | 0.75 | 1.29 | |||
| HEK293 (embryonic kidney) | 0.57 | -0.11 | 1.79 | |||
| liver | 0.09 | 0.91 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Lung, Muscle_Skeletal, Thyroid