rs11711842 chr3:61757728 A>C
- Sequence
aaatttattgtgtcaacacaaggc[A/C]tacagaagttgtatataaatattt
- ASB in cell types
- LHSAR (prostate epithelial cells) breast tumor tissue
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | 1.36 | -0.98 | 1.50 | |||
| breast tumor tissue | 1.69 | -0.78 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, homa-ir, simpson-angus scale, waist hip ratio