rs11719339 chr3:27369070 C>G
- Sequence
tgcctcacgcagtgactcacttac[C/G]caccacagccgcattctctacctc
- ASB in cell types
- neural cell HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.13 | 0.84 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.30 | 0.51 | 1.56 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Prostate, Testis