rs117214 chr21:29348513 C>T
- Sequence
gttccccaaagatgccccagtgtt[C/T]tgtaactcacaactcgtgatccta
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.41 | -2.37 | 2.17 | |||
| HEK293 (embryonic kidney) | 0.76 | -0.56 | 3.40 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, height, homa-b, lp-pla2 activity, pancreatic cancer, systolic blood pressure (sbp), type 2 diabetes, combined control dataset, gender differentiated
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood