rs11729839 chr4:140851407 T>A
- Sequence
agattaacttttcatttggcaaat[T/A]ttccagttactcagtgttgaagag
- ASB in cell types
- foreskin keratinocyte LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 2.15 | 3.50 | |||
| LNCaP (prostate carcinoma) | -0.49 | 1.53 | 1.75 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp), parkinsons disease, refractive error, waist hip ratio