rs11747909 chr5:28194509 G>T
- Sequence
agaattacagtcacgtggtgtcgc[G/T]cccagctgatttttgtatttttag
- ASB in cell types
- 501Mel-Cl8 (melanoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 501Mel-Cl8 (melanoma) | 1.57 | n/a | 1.33 |
Items per page:
1 – 1 of 1